Journal:

Article Title: A Second [2Fe-2S] Ferredoxin from Sphingomonas sp. Strain RW1 Can Function as an Electron Donor for the Dioxin Dioxygenase

doi:

Figure Lengend Snippet: E. coli strains and plasmids used in this study

Article Snippet: The bacterial strains, plasmids, and oligonucleotides used in this study are listed in Table and . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant genotype or characteristics Source or reference Strains BL21(DE3) F − ompT [ lon ] hsdS B (r B − m B − ; an E. coli B strain) with DE3 prophage Novagen DH5α F − endA1 hsdR17 (r K − m K + ) supE44 thi-1 λ − recA1 gyrA96 relA1 Δ( argF-lacZYA ) U169 φ80d lacZ ΔM15 Gibco BRL Plasmids pBluescript II KS Amp r lac′IPOZ′ , expression vector Stratagene pET9a Km r , T7 RNA polymerase promoter, expression vector Novagen pGEM-T Amp r , T7 RNA polymerase promoter, T-cloning vector Promega pAJ104 Km r , expression vector derived from pET9a encompassing fdx1 4 pAJ108 Tc r , cosmid vector derived from pLARF3 encompassing redA2 5 pAJ111 Km r , expression vector derived from pET9a encompassing redA2 5 pAJ114 Tc r , cosmid vector derived from pLARF3 encompassing fdx3 2 pAJ127 Km r , expression vector derived from pBBR1-MCS encompassing dxnA1A2 2 pAJ128 1.29-kb redA2 Eco RI- Not I PCR-amplified fragment into pGEM-T 2 pAJ129 0.33-kb fdx1 Not I- Bam HI PCR-amplified fragment into pGEM-T 2 pAJ130 Inserts from pAJ129 and pAJ128 cloned into pBluescript 2 pAJ146 0.34-kb fdx3 Nde I- Bam HI PCR-amplified fragment into pGEM-T This study pAJ147 0.33-kb fdx3 Nde I- Bam HI fragment from pAJ146 cloned into pET9a This study pAJ148 0.56-kb fdx3 Not I- Bam HI PCR-amplified fragment into pGEM-T This study pAJ149 Inserts from pAJ148 and pAJ128 cloned into pBluescript This study Open in a separate window E. coli strains and plasmids used in this study table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Oligonucleotide Primer sequence a Hybridization region AJ286 cggg catATG CCCAAAGTAATTTATG 5′ end of fdx3 Nde I AJ287 gcgc ggatcc GTTCAATCAAGATTGTTG 3′ end of fdx3 Bam HI AJ316 cccc ggatcc atgat gcggccGC CAGATTCTAGACCGGGATCAG 3′ end of redA2 Bam HI Not I AJ317 cgcg gaaTTC TGGAAGAGAAGGAAAG 5′ end of redA2 Eco RI AJ320 ccgg gcggccGC TCAATCTGATGCACCA 5′ end of fdx3 Not I AJ321 cgcc ggaTCC CATTAGAGATTACATCT 3′ end of fdx3 Bam HI Open in a separate window a Relevant recognition sequences for the restriction enzymes are underlined, and lowercase characters indicate the nonhomologous sequences to the corresponding DNA region from Sphingomonas sp. strain RW1.

Techniques: Plasmid Preparation, Expressing, Derivative Assay, Clone Assay